FastQCFastQC Report
Sat 27 Sep 2014
SRR351414.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR351414.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 22782194
Filtered Sequences 0
Sequence length 36
%GC 45

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[WARN] Per base sequence content

Per base sequence content

[WARN] Per base GC content

Per base GC content graph

[WARN] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[WARN] Sequence Duplication Levels

Duplication level graph

[WARN] Overrepresented sequences

Sequence Count Percentage Possible Source
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAT 141141 0.6195232996435724 Illumina Single End Adapter 2 (96% over 32bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 71700 0.314719469073084 Illumina Single End Adapter 2 (100% over 33bp)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 64499 0.28311145098667845 No Hit
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGGAA 41801 0.18348101153032056 Illumina Single End Adapter 2 (100% over 33bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGGAT 36081 0.15837368429045948 Illumina Single End Adapter 2 (100% over 33bp)

[FAIL] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
CTGCT 1400880 2.3553743 20.17912 27
CCTGG 1121740 2.2321053 5.088986 1
GGAAG 1428040 2.1694403 21.29605 5
TTCTG 1506070 2.136596 17.673891 25
TCTGC 1267380 2.1309137 20.025505 26
CTTCT 1424830 2.024224 17.393435 24
TCTTC 1344455 1.9100372 17.201685 23
GAAGA 1547845 1.8913141 17.149763 6
TGCTT 1329070 1.8854938 16.904448 28
ATGCC 1091495 1.7469206 19.769455 17
AAGAG 1409260 1.7219772 16.651205 7
GAGCT 1071205 1.7120078 20.372774 9
AGCTC 1067270 1.7081488 20.202063 10
AGAGC 1112380 1.6923054 19.487492 8
TGCCG 824375 1.6403906 23.709896 18
GCTCG 770450 1.5330874 24.431616 11
GTCTT 1057735 1.5005627 16.845314 22
GATCG 929130 1.4849424 21.372103 1
CTTGG 868025 1.4573807 5.7475114 30
GCTTG 840055 1.41042 9.962368 29
GCCGT 708595 1.4100047 23.111376 19
CCGTC 707020 1.408875 22.967028 20
ATCGG 796375 1.2727724 21.26229 2
CGGAA 797980 1.2139969 20.316496 4
TATGC 871995 1.1775616 16.38267 16
TCGGA 711060 1.1364213 21.173655 3
GTATG 841795 1.1351619 16.364714 15
CGTCT 662970 1.1146868 19.281334 21
CTCGT 653085 1.0980667 20.136423 12
TTAGA 905835 0.98249304 6.963189 31
GCTTA 671190 0.9063901 8.207627 29
TAGAT 829130 0.8992967 6.4944615 32
CTTAG 652760 0.8815019 7.9050484 30
CGTAT 590425 0.7973232 16.029854 14
TCGTA 578855 0.7816988 16.053219 13