FastQCFastQC Report
Sat 27 Sep 2014
SRR343303.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR343303.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 28293501
Filtered Sequences 0
Sequence length 36
%GC 54

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[OK] Per base sequence content

Per base sequence content

[OK] Per base GC content

Per base GC content graph

[WARN] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[OK] Sequence Duplication Levels

Duplication level graph

[WARN] Overrepresented sequences

Sequence Count Percentage Possible Source
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 127220 0.4496438952535425 Illumina Single End Adapter 2 (100% over 33bp)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 91562 0.32361495313004923 No Hit
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 31399 0.11097601530471608 No Hit

[WARN] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
TTTTT 1897340 3.8913527 4.6452503 25
AAAAA 2228130 3.8904989 4.9663076 2
CCCCC 5894365 3.8006535 4.7965617 16
CTGCT 1966165 2.1170115 8.417901 27
GGAAG 1792830 1.9999671 16.90356 5
TTCTG 1470605 1.99575 10.121076 25
TTGAA 1227580 1.9688402 9.245234 31
TCTGC 1790610 1.9279877 8.237877 26
TGCTT 1406405 1.9086246 9.960819 28
TGAAA 1220750 1.895873 8.899079 32
CTTCT 1416945 1.8293414 9.588968 24
CTTGA 1360860 1.7883208 7.7044554 30
GAAGA 1339660 1.7351565 18.176588 6
AAGAG 1279240 1.6568992 15.785952 7
ATGCC 1581995 1.6494161 8.025726 17
TCTTC 1246415 1.6091791 9.233986 23
GTCTT 1156725 1.5697854 9.452146 22
GCTTG 1337840 1.5141741 6.990799 29
GAGCT 1372250 1.503927 9.571364 9
AGCTC 1427370 1.4882013 8.10619 10
AGAGC 1253695 1.3304766 9.523846 8
GTATG 780780 1.0785218 9.29235 15
GATCG 974715 1.0682455 15.845652 1
TATGC 802190 1.0541666 8.892636 16
TGCCG 1042275 0.9359381 6.3044577 18
CGTCT 826620 0.89003927 7.232397 21
CGGAA 776100 0.82363164 15.147408 4
CCGTC 953315 0.8143907 5.8608837 20
ATCGG 724615 0.7941469 15.730412 2
GCCGT 879430 0.7897072 6.057005 19
TCGGA 705140 0.772803 15.602248 3
GCTCG 824820 0.7406687 6.244136 11
CTCGT 684065 0.7365473 7.199448 12
CGTAT 494420 0.64972264 8.50428 14
TCGTA 480865 0.63190985 8.474197 13