FastQCFastQC Report
Sat 27 Sep 2014
SRR343296.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR343296.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 32300772
Filtered Sequences 0
Sequence length 36
%GC 53

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[OK] Per base sequence content

Per base sequence content

[OK] Per base GC content

Per base GC content graph

[WARN] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[OK] Sequence Duplication Levels

Duplication level graph

[WARN] Overrepresented sequences

Sequence Count Percentage Possible Source
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 76047 0.23543400139166953 No Hit
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 54262 0.16798979293745672 No Hit
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 48426 0.14992211331667243 Illumina Single End Adapter 2 (100% over 33bp)
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 47856 0.14815744961142105 No Hit
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 35665 0.11041531762770251 No Hit
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 34857 0.10791382942797775 No Hit

[WARN] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
CCCAG 4191180 3.361051 3.9118261 24
CCAGG 3789960 3.0952272 3.9979718 1
GGCTG 3673300 3.0900187 3.788374 4
TTTTT 2046340 3.072063 3.539926 25
GGAGG 3561335 3.0165389 3.7577162 1