FastQCFastQC Report
Sat 27 Sep 2014
SRR343295.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR343295.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 15385971
Filtered Sequences 0
Sequence length 36
%GC 42

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[WARN] Per base sequence content

Per base sequence content

[OK] Per base GC content

Per base GC content graph

[WARN] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[FAIL] Sequence Duplication Levels

Duplication level graph

[FAIL] Overrepresented sequences

Sequence Count Percentage Possible Source
AGCTTACTGTTAATCTTATTTTGCACTGCCTGGTTG 221945 1.4425153927561674 No Hit
GATCCAAATTTCCAACAAAAGGTGGTAGATGGCCTG 144132 0.9367754560306918 No Hit
AGCTTGATCCCCGCCCTCCCGTAGAGGAGCCTCCAC 86643 0.5631298798106404 No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 82643 0.5371321705987877 No Hit
GATCCCTTCCCTGTCGGGCCGCGGACGCTTTTCGCC 81571 0.5301647845300111 No Hit
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAT 59692 0.38796381456847934 Illumina Single End Adapter 2 (96% over 32bp)
TCGAGTGGGTTTTGCTCCAGCGCGCTTACAAAGTCC 38639 0.25113137155919507 No Hit
AGCTTTAACAACCACGTGCGCACGCTTGTGGCGCGC 25826 0.1678542095263276 No Hit
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 22680 0.14740701123120536 Illumina Single End Adapter 2 (100% over 33bp)

[WARN] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
CACAC 1431450 3.569449 3.7612975 11
GTGTG 1229750 3.2924602 3.773087 32
ACACA 1669295 3.1557076 3.3218472 22
GCCTG 777055 2.6912327 27.346573 28
CCTGG 722590 2.5026002 27.613136 29
CACTG 935585 2.3788874 21.229101 24
CTGCC 675620 2.265972 26.613035 26
CCAGC 614595 2.0874827 6.472017 17
CTGCT 831350 2.087338 11.535467 27
GATGG 761890 2.0657501 14.898889 28
GGTGG 553865 2.0454946 19.330015 21
TGGCC 582460 2.0172772 18.437065 30
CCTCC 604925 1.9647448 11.056792 15
CAACA 1025380 1.9384228 11.113484 13
TGCAC 752645 1.9137309 20.728607 22
ACTGC 747240 1.8999877 20.624819 25
TTTTG 1349365 1.8986806 12.160882 19
CTGTT 984125 1.8497622 15.612837 7
TTTGC 982845 1.8473566 15.530296 20
ACAAA 1261715 1.8082712 8.635718 15
TCTGC 718285 1.8034564 11.243854 26
TTGCA 932635 1.7752486 15.724881 21
AACAA 1232165 1.7659205 8.656523 14
CAAAA 1230630 1.7637206 8.585604 16
CCCTG 523595 1.7560931 10.97475 9
ACTGT 916800 1.7451072 15.691114 6
GCCGC 374650 1.7332788 14.183623 18
GGGCC 360670 1.7230589 14.671651 16
GATCC 676680 1.7205766 21.666945 1
ATTTT 1649890 1.7043887 9.221823 18
CTGGT 656800 1.7029011 20.422722 30
GCACT 669335 1.7019005 20.515356 23
TCCAG 663095 1.6860344 5.0066924 16
AGCTT 879520 1.6741455 23.248587 1
GGCCT 483120 1.6732256 18.06719 31
CCGCC 372830 1.6703445 14.629688 11
CTCCA 675065 1.6622213 8.544286 31
TGCCT 660685 1.6588354 19.910025 27
GCGCG 346075 1.6533331 7.6893682 20
GGTTG 612670 1.6403266 21.200094 32
CGCGC 352565 1.6311048 7.484123 21
AGGTG 601305 1.6303481 14.297567 20
AAAAG 1096390 1.6226125 8.62516 17
ATGGC 614300 1.6129415 14.097301 29
TTCTG 850770 1.5991082 8.771713 25
AGAGC 598345 1.5910052 12.294241 8
TGGTT 809315 1.5708354 15.743255 31
TATTT 1495590 1.544992 9.063526 17
GGCCG 322555 1.540969 14.349638 17
GAGCT 576245 1.5130222 11.99223 9
GCTTG 582590 1.5104951 8.905833 2
GCCTC 450220 1.5099996 11.026269 29
GTGGT 563905 1.5097661 14.050747 22
GGAAG 549405 1.5085509 13.291069 5
CTGTC 598095 1.5016856 8.342905 11
AGAGG 544680 1.4955771 9.288566 23
TGCTT 793800 1.4920272 8.556468 28
TTATT 1433355 1.4807012 9.127033 16
AGCTC 582130 1.4801668 11.509744 10
CCAAA 782870 1.4799714 10.570727 4
AGATG 741410 1.475826 11.00833 27
CCCTC 450825 1.4642411 10.873673 14
CTCCC 449325 1.4593693 10.856099 16
TCCAA 779810 1.4556959 10.206874 3
ATCCA 774325 1.4454569 10.638055 2
GCTTT 768930 1.4452815 6.4949713 27
CAAAT 1019820 1.4432582 8.278229 5
TTTTC 1052205 1.4337565 5.095537 29
CGCCC 318755 1.4280789 14.476788 12
GCCCT 422845 1.4181862 11.119218 13
CAGCG 404020 1.4170467 5.920044 18
GGAGC 390670 1.4149425 11.686348 26
CTTTT 1038270 1.4147683 5.0840116 28
TACTG 739675 1.4079539 15.515202 5
TCCAC 570030 1.4035922 8.454588 32
GAAGA 694530 1.4000694 10.019887 6
GAGGA 509455 1.3988565 9.201264 24
TTTCC 768320 1.3984933 10.248144 9
AAAGG 691840 1.3946469 10.964324 18
AAGAG 691540 1.394042 9.831856 7
CCAAC 558060 1.3915728 13.440651 12
GGCGC 288870 1.3800428 5.370633 30
CCCGC 305985 1.370867 14.310185 10
AGGAG 498535 1.3688724 9.137064 25
TCCCT 559710 1.3608946 8.600499 3
GCTTA 712990 1.3571596 15.522899 2
GTGGG 366320 1.3528666 6.0562253 5
TCCCC 408785 1.3276988 10.779784 8
TGCCG 383225 1.3272518 14.547722 18
TTGAT 928930 1.323693 5.458979 4
TGTTA 926560 1.3203158 11.80765 8
TTCCA 715065 1.3180915 10.226436 10
CCTGT 524935 1.317997 8.155003 10
GAGCC 375485 1.3169639 11.258405 27
TTAAT 1250220 1.3079222 9.008938 10
ATGCC 503680 1.280694 11.060987 17
CGGGC 264680 1.264478 14.303372 15
CCGCG 268255 1.2410535 13.756679 19
CGCGG 258160 1.2333294 14.192464 20
TGATC 641430 1.2209468 6.8220215 5
AGCCT 479710 1.219746 8.425702 28
TCTTC 669890 1.2193313 8.135554 23
GCTCC 362120 1.2145196 5.6789117 14
CTTCC 496035 1.2060734 7.9911532 6
CTTCT 662260 1.2054433 8.120802 24
GTTAA 831535 1.1999596 11.798959 9
AGCGC 341890 1.1991339 5.679694 19
GCTCG 345105 1.195228 14.816686 11
AAATT 1124725 1.1915811 6.4175134 6
GCCGT 343925 1.1911411 14.228322 19
CCTTC 488730 1.1883118 8.640252 5
ATTTC 857375 1.1831169 7.8930163 8
CCCCG 263935 1.1824757 14.146456 9
ATCCC 479220 1.1799896 8.615433 2
CTTGA 618990 1.1782328 6.622445 3
AATTT 1126015 1.1779846 6.2442513 7
GCGCT 339045 1.1742399 5.7251105 22
TTCCC 477545 1.1611162 7.9169745 7
CCCTT 472845 1.1496886 8.590486 4
AATCT 821315 1.1477529 11.474956 12
TTACT 795810 1.0981616 11.327568 4
CCGTC 326640 1.0955228 13.700059 20
GTCTT 581350 1.092706 8.258943 22
ATCTT 790160 1.090365 11.31426 13
AAGGT 544820 1.0845006 10.330375 19
GTAGA 541815 1.0785189 10.393928 25
TCGCC 314820 1.0558795 10.173675 32
CTTAC 570085 1.0508474 14.562238 3
GATCG 397635 1.0440534 12.537447 1
CGCTT 405505 1.0181344 7.670082 26
GCGGA 281055 1.017935 10.83324 21
TAATC 720475 1.0068333 11.345556 11
GACGC 286575 1.0051239 10.542087 24
TAGAT 695810 1.0040995 7.772505 26
GGTAG 369080 1.000705 13.960279 24
GTATG 507800 0.9981311 8.598695 15
TATGC 516270 0.9827078 8.353653 16
ATCGG 362185 0.95097387 12.413508 2
CGGAA 355315 0.94478595 12.344212 4
CTTAT 675460 0.9320871 11.152357 15
GGACG 253635 0.9186243 10.821468 23
TGGTA 465755 0.91548747 10.099269 23
TCTTA 647170 0.8930489 11.116082 14
CGTCT 347350 0.87211984 10.299852 21
GTCGG 242165 0.8660806 10.619684 13
ACGCT 335040 0.8518974 7.6854153 25
TCCCG 252570 0.8470983 10.407783 17
TAGAG 423215 0.8424377 6.4603095 22
TCGGA 319990 0.8401842 12.121187 3
CTCGT 318090 0.79865444 10.573831 12
CGGAC 224595 0.7877372 10.341731 22
TCGGG 218860 0.7827324 10.507997 14
CCCGT 232215 0.77882934 10.214858 18
TGTCG 295415 0.7659296 7.8217993 12
TTCGC 280400 0.70402306 7.525485 31
TTTCG 302890 0.5693124 5.698681 30
CCGTA 206380 0.524757 7.6517954 19
CGTAG 198050 0.5200115 7.8871593 20
CGTAT 270105 0.51413846 7.919142 14
TCGTA 259210 0.4934001 7.895082 13