FastQCFastQC Report
Sat 27 Sep 2014
SRR343294.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR343294.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 32377395
Filtered Sequences 0
Sequence length 36
%GC 43

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[WARN] Per base sequence content

Per base sequence content

[OK] Per base GC content

Per base GC content graph

[OK] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[WARN] Sequence Duplication Levels

Duplication level graph

[WARN] Overrepresented sequences

Sequence Count Percentage Possible Source
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 101971 0.31494504113132016 No Hit
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 36782 0.11360395115172174 Illumina Single End Adapter 2 (100% over 33bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAT 34953 0.10795494819765457 Illumina Single End Adapter 2 (96% over 32bp)

[WARN] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
CCCCC 1931535 3.6519823 5.283727 32
GGAAG 1905795 2.4391665 20.236555 5
GAGGC 1318805 2.1840851 6.053361 9
CTGCT 1829845 2.1604307 7.9949546 27
TTCTG 2266735 2.0711536 6.8388295 25
TCTGC 1711065 2.0201917 7.9253316 26
CTTCT 2103725 1.8436211 6.441222 24
GAAGA 1924645 1.8258426 14.072473 6
TGCTT 1901885 1.737784 6.3059497 28
TCTTC 1950755 1.7095643 6.207241 23
AAGAG 1779395 1.6880491 11.746645 7
ATGCC 1393250 1.6426531 8.0944195 17
GGCTC 1019530 1.6216958 5.3175025 11
AGAGC 1232755 1.5132587 10.188383 8
GAGCT 1132305 1.3919034 9.49125 9
AGCTC 1150480 1.3564253 8.07905 10
GTCTT 1453005 1.3276349 6.027932 22
TGCCG 777040 1.2359837 9.78159 18
CCGTC 686115 1.0467366 8.886235 20
GCCGT 657960 1.0465714 9.216887 19
CGGAA 850045 1.0434662 18.179125 4
TATGC 1132985 1.033776 5.8826656 16
GATCG 810040 0.9957541 17.979204 1
GTATG 1040685 0.9900348 6.0638413 15
ATCGG 758080 0.9318815 18.167105 2
TCGGA 731100 0.8987159 17.949802 3
GCTCG 548540 0.8725246 9.653364 11
CGTCT 705285 0.83270407 6.880315 21
CTCGT 548085 0.6471038 6.9634476 12
CGTAT 590395 0.53869754 5.3886323 14
TCGTA 537815 0.49072167 5.3415527 13