FastQCFastQC Report
Sat 27 Sep 2014
SRR343293.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR343293.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 20514796
Filtered Sequences 0
Sequence length 36
%GC 43

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[OK] Per base sequence content

Per base sequence content

[OK] Per base GC content

Per base GC content graph

[OK] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[WARN] Sequence Duplication Levels

Duplication level graph

[WARN] Overrepresented sequences

Sequence Count Percentage Possible Source
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAT 38910 0.1896679840247985 Illumina Single End Adapter 2 (96% over 32bp)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 38521 0.18777179163760635 No Hit
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 29776 0.14514402190497044 Illumina Single End Adapter 2 (100% over 33bp)

[FAIL] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
GGAAG 1322025 2.4533205 23.037476 5
CTGCT 1261075 2.3517015 10.082718 27
TCTGC 1178070 2.1969106 10.015468 26
TTCTG 1512605 2.1486673 8.339414 25
GAGGC 889735 2.1449494 6.593899 9
CTTCT 1392345 2.0035942 8.2995 24
GAAGA 1311610 1.8980023 17.057589 6
TCTTC 1292900 1.8604921 7.999918 23
TGCTT 1293565 1.8375194 7.7849894 28
AGGCT 976450 1.8164688 5.172881 10
ATGCC 950000 1.790279 10.268782 17
AAGAG 1207985 1.7480489 14.400046 7
GGCTC 693445 1.6758369 6.0226364 11
AGAGG 898935 1.66818 5.1467633 8
AGAGC 842115 1.5830884 12.738561 8
GAGCT 788145 1.4661691 11.793958 9
AGCTC 771695 1.4542626 10.319513 10
GTCTT 1015425 1.4424193 7.5205445 22
TGCCG 583060 1.4090713 12.124396 18
GCTTG 734025 1.3512415 5.014188 29
CCGTC 515030 1.2608732 11.744495 20
GCCGT 507560 1.2266117 11.592155 19
GATCG 641640 1.1936289 21.881466 1
CGGAA 625830 1.1764952 22.109251 4
TATGC 780670 1.1206423 7.456244 16
ATCGG 588705 1.0951551 21.820955 2
TCGGA 572930 1.0658094 21.623064 3
GTATG 747370 1.059049 7.3357706 15
GCTCG 426840 1.031537 12.078511 11
CGTCT 538915 1.0049896 8.988881 21
CTCGT 417795 0.7791203 9.047161 12
CGTAT 441985 0.6344642 6.9665704 14
TCGTA 406295 0.5832316 6.910965 13