FastQCFastQC Report
Sat 27 Sep 2014
SRR343291.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR343291.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 27940033
Filtered Sequences 0
Sequence length 36
%GC 44

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[WARN] Per base sequence content

Per base sequence content

[OK] Per base GC content

Per base GC content graph

[FAIL] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[WARN] Sequence Duplication Levels

Duplication level graph

[FAIL] Overrepresented sequences

Sequence Count Percentage Possible Source
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 426366 1.526003924190068 Illumina Single End Adapter 2 (100% over 33bp)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 72662 0.2600641166028687 No Hit

[WARN] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
CCCAG 1824420 3.0668824 3.5836132 8
CTGGG 1793855 3.046768 4.9846544 1
GGAAG 1814925 2.5784154 26.815289 5
CTGCT 1961155 2.5442963 23.226381 27
TCTGC 1796870 2.3311617 23.083355 26
TTCTG 2173655 2.2355418 18.90619 25
AGAGC 1527775 2.130528 25.710009 8
CTTCT 2044070 2.063581 18.494806 24
AAGAG 1795850 2.0393283 20.954683 7
GAAGA 1776755 2.0176444 21.031641 6
TGAAA 2250190 1.9884115 15.812293 32
GAGCT 1457345 1.9785058 24.977098 9
AGCTC 1474930 1.9655318 24.54654 10
TGCTT 1828080 1.8801275 18.612757 28
TCTTC 1840710 1.85828 17.774763 23
ATGCC 1387275 1.8487203 24.458992 17
GCTTG 1324145 1.7500789 23.401012 29
TTGAA 1958020 1.6844239 15.135309 31
CTTGA 1575050 1.6639464 18.150219 30
GTCTT 1459705 1.5012645 18.121538 22
TGCCG 784865 1.308521 29.85715 18
GCTCG 739625 1.2330972 29.889898 11
CCGTC 739965 1.2109622 27.769709 20
TATGC 1129070 1.192795 18.558126 16
GTATG 1086675 1.169529 18.922197 15
GCCGT 696840 1.1617665 28.459476 19
CGGAA 772820 1.0777205 24.667913 4
CGTCT 782850 1.0156271 22.039793 21
CTCGT 740150 0.96023047 22.554407 12
GATCG 697430 0.9468378 23.921799 1
TCGGA 695145 0.94373566 23.75424 3
ATCGG 661455 0.8979978 23.886023 2
CGTAT 675775 0.71391594 18.061127 14
TCGTA 647925 0.68449414 18.150894 13