FastQCFastQC Report
Sat 27 Sep 2014
SRR343290.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR343290.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 20386439
Filtered Sequences 0
Sequence length 36
%GC 45

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[WARN] Per base sequence content

Per base sequence content

[WARN] Per base GC content

Per base GC content graph

[WARN] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[WARN] Sequence Duplication Levels

Duplication level graph

[WARN] Overrepresented sequences

Sequence Count Percentage Possible Source
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAT 90534 0.4440893282048915 Illumina Single End Adapter 2 (96% over 32bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 85814 0.42093668246818383 Illumina Single End Adapter 2 (100% over 33bp)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 63130 0.30966663672846445 No Hit
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGGAA 46283 0.22702836920170313 Illumina Single End Adapter 2 (100% over 33bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAA 30609 0.15014392655823805 Illumina Single End Adapter 2 (96% over 32bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGGAT 21757 0.1067229053588025 Illumina Single End Adapter 2 (100% over 33bp)
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 20670 0.10139092952918358 No Hit

[WARN] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
AAAAA 3261930 3.0836565 4.233 2
TTTTT 2666545 3.0697362 3.9688306 7
CTGCT 1276085 2.3174422 20.282106 27
GGAAG 1263950 2.2350783 22.921793 5
TTCTG 1362360 2.1439028 18.141783 25
TCTGC 1159020 2.1048453 20.093319 26
CTTCT 1309920 2.008302 17.508087 24
GAAGA 1355595 1.9455198 18.538311 6
TCTTC 1233100 1.8905256 17.165745 23
TGCTT 1198130 1.8854593 17.338625 28
AAGAG 1240115 1.7797853 18.020073 7
ATGCC 988135 1.7251757 19.770147 17
GAGCT 959005 1.7185688 21.083948 9
AGAGC 992115 1.709212 20.432486 8
TGAAA 1394680 1.6897999 5.219484 32
AGCTC 964180 1.683353 20.363405 10
TGCCG 765135 1.6459337 23.642275 18
GCTCG 708805 1.5247585 24.459997 11
GTCTT 954415 1.5019327 17.1167 22
GATCG 834240 1.4949858 22.25962 1
TTGAA 1168720 1.4729339 5.105123 31
GCTTG 780930 1.4556948 11.494397 29
CTTGG 776735 1.447875 5.7992992 30
CCGTC 669790 1.4037313 22.299925 20
GCCGT 651790 1.4021095 22.818867 19
ATCGG 726905 1.3026378 22.191914 2
CTTGA 832325 1.259198 5.680257 30
CGGAA 720270 1.2408783 21.351501 4
TATGC 782330 1.183562 16.754818 16
TCGGA 651965 1.168343 22.016804 3
GTATG 748670 1.1625736 17.218094 15
CGTCT 617640 1.1216689 19.182863 21
CTCGT 604090 1.0970613 20.04265 12
TTAGA 774140 0.97564614 6.5044503 31
GCTTA 575840 0.8711699 7.511501 29
TAGAT 687815 0.8668509 5.245814 32
CTTAG 559695 0.8467447 7.0822277 30
CGTAT 530165 0.8020697 16.456884 14
TCGTA 523750 0.79236466 16.500025 13