FastQCFastQC Report
Sat 27 Sep 2014
SRR343289.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR343289.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 29002663
Filtered Sequences 0
Sequence length 36
%GC 46

[FAIL] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[WARN] Per base sequence content

Per base sequence content

[WARN] Per base GC content

Per base GC content graph

[WARN] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[WARN] Sequence Duplication Levels

Duplication level graph

[FAIL] Overrepresented sequences

Sequence Count Percentage Possible Source
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 340222 1.173071590012269 Illumina Single End Adapter 2 (100% over 33bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAT 274677 0.9470751013450041 Illumina Single End Adapter 2 (96% over 32bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGGAA 192718 0.6644838096418939 Illumina Single End Adapter 2 (100% over 33bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAA 102961 0.35500533175177745 Illumina Single End Adapter 2 (96% over 32bp)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 83030 0.2862840560537493 No Hit
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGGAT 75119 0.2590072504721377 Illumina Single End Adapter 2 (100% over 33bp)

[FAIL] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
CCCCC 5335095 7.1007934 11.713091 32
GGAAG 2508425 3.5608737 64.17646 5
AAAAA 4176925 3.3142147 3.7220745 2
TTTTT 3990530 3.1066983 3.6337242 7
GAAGA 2654190 3.1036801 52.653137 6
CTGCT 2555655 3.0046287 46.861374 27
TGCCG 2072375 2.9690568 59.034378 18
GATCG 2250185 2.9069679 58.236897 1
TTCTG 2683075 2.8336234 43.195724 25
AAGAG 2420655 2.8305957 51.22186 7
TCTGC 2397940 2.8192065 46.727802 26
GCTCG 1927715 2.7618053 60.42412 11
AGAGC 2084430 2.7030895 54.604755 8
ATCGG 2084370 2.692755 58.771706 2
GAGCT 2075085 2.6807597 54.862156 9
ATGCC 2247585 2.6525023 49.239765 17
TGCTT 2498480 2.6386707 41.913357 28
GCCGT 1839350 2.6352062 57.02697 19
CTTCT 2712475 2.6169338 39.366352 24
CGGAA 1971440 2.556564 58.038395 4
TCTTC 2636870 2.5439916 38.675705 23
AGCTC 2110785 2.491057 49.831566 10
TCGGA 1914785 2.4736717 58.490723 3
CCGTC 1853245 2.4254963 52.230873 20
GTCTT 2134845 2.254632 41.844353 22
GTATG 1874730 2.1756124 47.858894 15
TATGC 1955110 2.072677 43.7596 16
GCTTG 1573545 2.025117 30.403086 29
CGTCT 1719410 2.0214734 46.5451 21
CTCGT 1719390 2.0214498 48.595764 12
TGAAA 2052670 1.9697107 13.300889 32
TGGAA 1625305 1.8933407 9.530636 32
TTGAA 1858520 1.7766404 13.376544 31
CGTAT 1636660 1.7350775 43.537388 14
TCGTA 1627425 1.7252873 43.669624 13
CTTGG 1227305 1.5795139 13.759628 30
CTTGA 1390060 1.4736488 14.369233 30
TTGGA 1269100 1.4727826 12.462519 31
TTAGA 1383565 1.3226101 14.822228 31
GCTTA 1153005 1.2223389 16.526848 29
TAGAT 1231955 1.1776794 11.325526 32
CTTAG 1030840 1.0928277 15.109032 30