FastQCFastQC Report
Sat 27 Sep 2014
SRR343288.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR343288.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 20991100
Filtered Sequences 0
Sequence length 36
%GC 46

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[WARN] Per base sequence content

Per base sequence content

[WARN] Per base GC content

Per base GC content graph

[WARN] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[FAIL] Sequence Duplication Levels

Duplication level graph

[FAIL] Overrepresented sequences

Sequence Count Percentage Possible Source
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAT 302922 1.443097312670608 Illumina Single End Adapter 2 (96% over 32bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 243020 1.1577287517090578 Illumina Single End Adapter 2 (100% over 33bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGGAA 160049 0.762461233570418 Illumina Single End Adapter 2 (100% over 33bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAA 91661 0.43666601559708634 Illumina Single End Adapter 2 (96% over 32bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGGAT 76450 0.36420197131165116 Illumina Single End Adapter 2 (100% over 33bp)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 63755 0.30372395920175693 No Hit
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 25761 0.1227234399340673 No Hit
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 24627 0.11732115039230911 No Hit

[FAIL] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
GGAAG 1986380 3.4408166 63.73327 5
CTGCT 2004375 3.380632 54.739807 27
TGCCG 1634215 3.2309406 65.615845 18
AAAAA 3048265 3.17876 3.548179 2
TCTGC 1880180 3.1711614 54.50897 26
GATCG 1817860 3.107202 62.03845 1
GAAGA 2111855 3.0888622 53.793724 6
GCTCG 1559485 3.083195 67.218414 11
TTCTG 2058065 3.0320144 48.876877 25
CTTCT 2054645 2.9563434 47.66673 24
GCCGT 1478230 2.9225488 64.21768 19
ATGCC 1744875 2.9128582 55.80993 17
TCTTC 2007825 2.8889763 47.277584 23
CCGTC 1474185 2.8465426 62.706715 20
ATCGG 1664010 2.8442318 62.240284 2
AGAGC 1678735 2.8400586 58.615593 8
GAGCT 1660135 2.8376086 58.7643 9
TGCTT 1920105 2.8287668 47.394894 28
AAGAG 1914365 2.8000073 52.47991 7
AGCTC 1671010 2.7895496 56.895966 10
CGGAA 1578220 2.670009 61.557117 4
TCGGA 1530535 2.6160877 61.96215 3
GTCTT 1685795 2.483573 47.88529 22
CGTCT 1395265 2.3532913 54.443775 21
CTCGT 1383975 2.334249 56.32851 12
TATGC 1525860 2.2249634 48.449017 16
GTATG 1475175 2.202449 49.554443 15
GCTTG 1162120 2.006892 30.200026 29
CGTAT 1293560 1.8862308 48.171055 14
TCGTA 1293230 1.8857495 48.269238 13
TGAAA 1477795 1.8439447 11.77856 32
TGGAA 1210930 1.7894411 9.454906 32
TTGAA 1314910 1.657653 11.903989 31
CTTGG 931705 1.6089829 15.301703 30
CTTGA 984115 1.4350073 13.386681 30
TTGGA 954925 1.4257113 13.211433 31
TTAGA 1124465 1.4175667 18.921791 31
GCTTA 936235 1.3651901 21.270994 29
TAGAT 1027200 1.2949488 15.096594 32
CTTAG 869690 1.2681562 20.374525 30