FastQCFastQC Report
Sat 27 Sep 2014
SRR343287.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR343287.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 29702117
Filtered Sequences 0
Sequence length 36
%GC 44

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[WARN] Per base sequence content

Per base sequence content

[WARN] Per base GC content

Per base GC content graph

[FAIL] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[FAIL] Sequence Duplication Levels

Duplication level graph

[FAIL] Overrepresented sequences

Sequence Count Percentage Possible Source
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAT 642084 2.16174490188696 Illumina Single End Adapter 2 (96% over 32bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 462503 1.557138166279528 Illumina Single End Adapter 2 (100% over 33bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGGAA 317275 1.068189853268708 Illumina Single End Adapter 2 (100% over 33bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGGAT 161460 0.5435976162911216 Illumina Single End Adapter 2 (100% over 33bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAA 139382 0.4692662142567144 Illumina Single End Adapter 2 (96% over 32bp)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 90520 0.3047594216937466 No Hit

[FAIL] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
GGAAG 3357370 4.5545826 97.79638 5
CCCCC 2589455 4.5389066 6.0376215 32
CTGCT 3463165 4.1548715 77.70828 27
TGCCG 2604440 4.004151 100.02886 18
TCTGC 3331130 3.9964652 77.59639 26
GCTCG 2520410 3.8749604 101.60822 11
AGAGC 2944295 3.841573 87.804276 8
GCCGT 2482850 3.8172147 98.37173 19
CCGTC 2516830 3.7215884 95.03888 20
GAAGA 3432490 3.7162755 77.23982 6
GAGCT 2899945 3.6996164 85.413414 9
ATGCC 2988320 3.6666749 80.47532 17
TTCTG 3700140 3.6017418 64.35062 25
AGCTC 2928920 3.593791 81.44499 10
AAGAG 3315215 3.5893047 75.35325 7
GATCG 2722710 3.473508 91.46867 1
CGGAA 2599605 3.3918383 93.22263 4
CTTCT 3615055 3.384447 61.922356 24
AAAAA 4861190 3.352275 3.756782 5
ATCGG 2617850 3.3397324 91.89532 2
TGCTT 3405505 3.3149424 62.97179 28
TCGGA 2554365 3.2587411 91.35132 3
TCTTC 3474315 3.2526848 61.15055 23
CGTCT 2488865 2.9859722 76.93439 21
GTCTT 3051905 2.9707456 63.13322 22
CTCGT 2409450 2.8906958 78.21616 12
GTATG 2679565 2.7735832 67.12355 15
TATGC 2746050 2.7337809 64.736824 16
GCTTG 1906780 2.378519 42.862324 29
CGTAT 2324815 2.3144279 64.30448 14
TCGTA 2301445 2.2911623 64.385056 13
TGGAA 1850180 1.958627 12.915739 32
TGAAA 2277640 1.9242967 15.099342 32
CTTGG 1490155 1.8588209 21.959305 30
GCTTA 1670805 1.66334 29.166914 29
TTGAA 1961050 1.6199992 14.9483595 31
TTAGA 1891580 1.562611 24.085203 31
TTGGA 1508880 1.5618222 18.253084 31
CTTAG 1563895 1.5569077 27.85607 30
CTTGA 1546595 1.539685 17.594507 30
TAGAT 1695055 1.400264 19.877098 32
TGGAT 1081185 1.1191206 6.775455 32
TAGAA 1216810 1.0280393 5.0309963 32