FastQCFastQC Report
Sat 27 Sep 2014
SRR343286.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR343286.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 22191492
Filtered Sequences 0
Sequence length 36
%GC 42

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[WARN] Per base sequence content

Per base sequence content

[OK] Per base GC content

Per base GC content graph

[OK] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[WARN] Sequence Duplication Levels

Duplication level graph

[WARN] Overrepresented sequences

Sequence Count Percentage Possible Source
AGCTTACTGTTAATCTTATTTTGCACTGCCTGGTTG 101634 0.4579863309776558 No Hit
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 71264 0.3211320807091294 No Hit
GATCCAAATTTCCAACAAAAGGTGGTAGATGGCCTG 68047 0.3066355340145674 No Hit
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAT 58330 0.26284848265272115 Illumina Single End Adapter 2 (96% over 32bp)
AGCTTGATCCCCGCCCTCCCGTAGAGGAGCCTCCAC 39603 0.17846028559053173 No Hit
GATCCCTTCCCTGTCGGGCCGCGGACGCTTTTCGCC 38910 0.1753374671698505 No Hit
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 23355 0.10524303638529578 Illumina Single End Adapter 2 (100% over 33bp)

[WARN] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
CACAC 1852130 3.2861218 3.4598095 11
GTGTG 1772600 3.2457914 4.059405 2
CTGCT 1201730 2.1610606 9.212412 27
CCTGG 827560 2.0340543 10.139588 29
CACTG 1115245 2.0011 8.154082 24
GCCTG 780355 1.9180297 9.908801 28
TCTGC 1019480 1.8333222 8.921745 26
CCCTG 750670 1.8284676 5.0339627 9
CTGCC 745735 1.8164468 9.885671 26
GGTGG 699380 1.7503548 7.2944384 21
TTTTG 1778550 1.7432909 5.018698 19
TGGCC 694190 1.7062452 7.2935805 30
GGGCC 494430 1.661005 6.0800295 16
TTCTG 1242145 1.6491274 6.989133 25
CTGTT 1229435 1.6322532 5.979131 7
ACTGC 898265 1.6117699 7.685018 25
TGCAC 897785 1.6109085 7.688534 22
TTGCA 1206495 1.5982546 6.062131 21
GCCGC 474595 1.5800265 5.9185047 18
TTTGC 1183690 1.57152 6.018661 20
TGCTT 1157800 1.5371473 6.7352514 28
CCGCC 459100 1.5146897 6.092245 11
ACTGT 1139000 1.5088434 5.8971295 6
AGAGC 825575 1.4914837 9.276276 8
GATGG 816220 1.4912676 5.6995378 28
GAGCT 797290 1.4435763 9.132036 9
GGCCT 584825 1.4374377 7.0197325 31
AGCTC 798565 1.4328767 8.927878 10
AGGTG 771940 1.4103662 5.447951 20
CTGGT 767050 1.3919017 7.3080745 30
GGAAG 735655 1.3410996 9.9760685 5
GGCCG 398780 1.3396752 5.631671 17
GCACT 743170 1.3334807 7.41029 23
TGCCT 734420 1.3207011 7.309204 27
TGGTT 971485 1.3014964 5.722747 31
AGCTT 978575 1.296327 8.259689 1
TGCCG 523790 1.28742 11.2485485 18
ATGCC 713580 1.2803869 8.611269 17
ATGGC 706375 1.2789654 5.423641 29
GGTTG 688005 1.2597996 7.2707634 32
GAAGA 942815 1.2547258 7.5000935 6
GTGGT 675800 1.2374511 5.2484245 22
AAGAG 925125 1.2311834 7.287701 7
CGCCC 369810 1.2200989 5.7666483 12
CCAAC 680265 1.2069529 5.357702 12
CTTCT 917005 1.2065039 6.47064 24
TCTTC 907765 1.1943469 6.422764 23
TACTG 895815 1.1866941 5.7686596 5
CCCGC 355720 1.1736122 5.684413 10
GCCGT 454285 1.1165842 10.918121 19
GCTCG 449010 1.1036189 11.33555 11
GTCTT 796635 1.0576484 6.30056 22
CCGCG 316105 1.0523801 5.374417 19
GATCC 584260 1.0483462 8.01711 1
CGGGC 311850 1.0476395 5.449841 15
CCGTC 428685 1.0441827 10.68438 20
CGCGG 305595 1.0266261 5.36482 20
GCTTA 756270 1.0018376 5.541078 2
GTATG 734920 0.9823933 6.444379 15
CCCCG 293845 0.96947056 5.509655 9
TATGC 725080 0.96051985 6.368823 16
GATCG 497455 0.900694 9.935956 1
CGTCT 459020 0.82545173 7.914476 21
ATCGG 450960 0.81651 9.641622 2
CGGAA 444720 0.80343115 9.377963 4
CTTAC 555645 0.7294457 5.125694 3
CTCGT 398495 0.7166101 8.116294 12
TCGGA 386715 0.7001877 9.353013 3
CGTAT 355295 0.47066244 5.901669 14
TCGTA 331405 0.43901512 5.8762546 13