FastQCFastQC Report
Sat 27 Sep 2014
SRR351411.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR351411.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 22653839
Filtered Sequences 0
Sequence length 36
%GC 44

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[OK] Per base sequence content

Per base sequence content

[WARN] Per base GC content

Per base GC content graph

[FAIL] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[WARN] Sequence Duplication Levels

Duplication level graph

[WARN] Overrepresented sequences

Sequence Count Percentage Possible Source
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAT 207738 0.9170101367807902 Illumina Single End Adapter 2 (96% over 32bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 110969 0.48984633465436034 Illumina Single End Adapter 2 (100% over 33bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGGAA 78894 0.34825885360975684 Illumina Single End Adapter 2 (100% over 33bp)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 54080 0.23872333514862537 No Hit
GATCGGAAGAGGCTCGTATGCCGTCTTCTGCTTTGA 43068 0.19011347259950068 Illumina Single End Adapter 2 (95% over 23bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGGAT 42986 0.18975150304546615 Illumina Single End Adapter 2 (100% over 33bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAA 31265 0.13801192813279903 Illumina Single End Adapter 2 (96% over 32bp)
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 24750 0.10925300563847037 No Hit

[FAIL] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
GGAAG 1955360 3.275725 48.94407 5
CTGCT 1964945 3.1214242 29.428467 27
TCTGC 1813310 2.8805432 29.252396 26
TTCTG 2156965 2.7800515 24.540298 25
GAAGA 1995585 2.7382238 39.200977 6
CTTCT 2129200 2.7208958 24.287178 24
TCTTC 1984445 2.535914 23.910677 23
AAGAG 1793420 2.4608252 34.921276 7
TGCTT 1908910 2.4603398 23.870996 28
ATGCC 1509020 2.4407444 30.444433 17
AGAGC 1447660 2.4045458 34.545 8
AGCTC 1410845 2.2819526 31.261719 10
GAGCT 1379280 2.2500596 33.039124 9
TGCCG 1077395 2.1275718 35.932003 18
GTCTT 1610250 2.0754054 23.64403 22
TGGAA 1519670 2.0479674 5.7312746 32
TGAAA 1809780 1.9976418 6.1181417 32
GCCGT 1003130 1.9809178 35.026836 19
CGGAA 1189315 1.9754376 47.243515 4
CCGTC 1002510 1.9628348 34.734768 20
AGAGG 1147085 1.9216589 7.723389 8
GCTCG 939230 1.8547323 36.76583 11
GTATG 1371550 1.8153507 24.73351 15
TATGC 1353410 1.7760862 24.508379 16
GATCG 1079590 1.7611663 46.390137 1
GAGGC 855640 1.7351599 8.658259 9
TCGGA 1058560 1.7268597 46.057976 3
ATCGG 1054795 1.7207175 46.212246 2
GCTTG 1047625 1.6785041 14.469669 29
CTTGG 1035435 1.6589733 8.205175 30
AGGCT 1005020 1.6395184 7.205701 10
CGTCT 1028980 1.6345918 28.1878 21
GGCTC 763080 1.5068823 8.165621 11
CTCGT 925035 1.4694694 29.100805 12
CTTGA 1081805 1.4196577 6.440062 30
TTGGA 990375 1.3108367 6.73611 31
TTGAA 1203800 1.3050324 5.4482856 31
CTTAG 981390 1.2878826 11.764824 30
TTAGA 1141895 1.2379215 10.075234 31
CGTAT 932530 1.2237635 23.980444 14
GCTTA 902395 1.1842171 12.001506 29
TCGTA 894505 1.173863 23.980719 13
TAGAT 920060 0.9974314 8.698764 32