FastQCFastQC Report
Sat 27 Sep 2014
SRR351408.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR351408.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 23469806
Filtered Sequences 0
Sequence length 36
%GC 45

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[OK] Per base sequence content

Per base sequence content

[WARN] Per base GC content

Per base GC content graph

[OK] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[WARN] Sequence Duplication Levels

Duplication level graph

[WARN] Overrepresented sequences

Sequence Count Percentage Possible Source
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAT 66038 0.2813742900133048 Illumina Single End Adapter 2 (96% over 32bp)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 49617 0.2114077977466026 No Hit
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 34119 0.14537401800423913 Illumina Single End Adapter 2 (100% over 33bp)

[WARN] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
CACAC 2184430 3.3204317 3.79725 1
GTGTG 1990180 3.1205049 3.755538 2
ACACA 2421660 3.0947535 3.3682911 6
CTGCT 1568755 2.3887417 10.177518 27
GGAAG 1471510 2.3372078 16.493637 5
TTCTG 1666825 2.1201162 8.897929 25
TCTGC 1373320 2.091153 9.967986 26
CTTCT 1631430 2.0449321 8.669012 24
GAAGA 1470610 1.9352133 13.314732 6
TCTTC 1472525 1.845751 8.474952 23
TGCTT 1429865 1.8187155 8.387333 28
AAGAG 1373695 1.8076804 11.819342 7
AGAGC 1120145 1.7532712 11.421097 8
AGCTC 1054875 1.6166494 10.398263 10
GAGCT 1030795 1.6030475 10.961847 9
ATGCC 986360 1.5116469 9.881206 17
GTCTT 1095860 1.3938781 8.050669 22
GCTTG 859550 1.3281418 5.0747404 29
GTATG 864775 1.123396 8.190763 15
TATGC 819870 1.04958 8.043267 16
TGCCG 505415 0.93490124 10.873099 18
CGGAA 562800 0.8809048 14.842234 4
GCCGT 446515 0.8259499 10.514762 19
CCGTC 449495 0.819376 10.362032 20
GCTCG 425345 0.7867902 11.136269 11
CGTCT 469090 0.7142829 8.681331 21
GATCG 449160 0.6985141 14.7851095 1
TCGGA 447245 0.69553596 14.583252 3
ATCGG 441555 0.68668705 14.659253 2
CTCGT 417960 0.6364273 8.982186 12
CGTAT 392840 0.50290537 7.485512 14
TCGTA 359310 0.45998096 7.4727077 13