FastQCFastQC Report
Sat 27 Sep 2014
SRR351407.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR351407.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 21598823
Filtered Sequences 0
Sequence length 36
%GC 47

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[WARN] Per base sequence content

Per base sequence content

[WARN] Per base GC content

Per base GC content graph

[WARN] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[WARN] Sequence Duplication Levels

Duplication level graph

[WARN] Overrepresented sequences

Sequence Count Percentage Possible Source
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 106501 0.4930870538639999 Illumina Single End Adapter 2 (100% over 33bp)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 77292 0.3578528329992796 No Hit
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAT 59100 0.273626021195692 Illumina Single End Adapter 2 (96% over 32bp)
GATCGGAAGAGCTGTATGCCGTCTTCTGCTTAGATC 44007 0.20374721344769575 No Hit
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGGAA 31864 0.14752655734990744 Illumina Single End Adapter 2 (100% over 33bp)
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTAGAA 28643 0.13261370770064645 Illumina Single End Adapter 2 (96% over 32bp)
AGCTTACTGTTAATCTTATTTTGCACTGCCTGGTTG 28629 0.1325488893538319 No Hit

[FAIL] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
GGAAG 1871785 3.1032865 48.12025 5
CTGCT 1942680 3.0576496 17.44589 27
CACAC 1924280 3.0486066 3.1698472 27
TCTGC 1818035 2.8614666 17.213987 26
TTCTG 1962300 2.7481365 15.751016 25
GAAGA 1816245 2.667849 40.379562 6
CTTCT 1902920 2.6249185 15.37495 24
TGCTT 1800300 2.5212607 15.347526 28
TCTTC 1766535 2.4367867 15.089975 23
ATGCC 1492300 2.3744047 17.393675 17
AAGAG 1604550 2.3568945 33.681683 7
GTCTT 1456635 2.0399694 14.834831 22
TGCCG 1127075 2.024093 18.744236 18
AGAGC 1204425 1.9668355 23.835472 8
CGGAA 1184045 1.9335549 46.56798 4
GATCG 1188230 1.9194494 46.02827 1
GAGGC 1037305 1.911938 11.55448 9
TGAAA 1471035 1.8937327 6.896967 32
AGGCT 1172110 1.8934095 10.1236515 10
AGAGG 1130375 1.8740814 10.657822 8
ATCGG 1144450 1.8487278 46.3438 2
GAGCT 1129400 1.8244164 21.819704 9
GCCGT 1008240 1.8106794 18.18288 19
TCGGA 1116075 1.8028911 45.780308 3
CCGTC 1003470 1.7750248 17.94629 20
AGCTC 1100325 1.7507316 17.978554 10
TATGC 1199645 1.6983911 14.880963 16
GCTTG 1061135 1.6956441 10.849121 29
GGCTC 911145 1.6363082 10.752853 11
GTATG 1122530 1.6134686 15.032715 15
CGTCT 1008225 1.5868794 15.941138 21
CTTTG 1101895 1.5431675 5.3470335 31
CTTGA 1043745 1.4776765 7.0060253 30
GCTTT 1051605 1.4727381 5.5750146 30
TTGAA 1154965 1.4707958 6.5102305 31
GCTCC 770825 1.3635021 6.635063 12
GCTTA 881790 1.2483897 6.7939878 28
GCTCG 688780 1.2369671 18.96384 11
TTAGA 915985 1.1664655 5.861871 30
AGATC 812590 1.1629702 5.0794487 32
CTTAG 810640 1.1476593 6.378606 29
AAGAC 763350 1.1044167 5.1227493 7
CTCGT 701650 1.1043506 16.140001 12
CGTAT 765425 1.0836464 14.384733 14
TCGTA 724425 1.0256009 14.390141 13
GACTC 552195 0.8785997 5.0176888 9