FastQCFastQC Report
Sat 27 Sep 2014
SRR351406.fastq

Summary

[OK] Basic Statistics

Measure Value
Filename SRR351406.fastq
File type Conventional base calls
Encoding Sanger / Illumina 1.9
Total Sequences 27494871
Filtered Sequences 0
Sequence length 36
%GC 50

[OK] Per base sequence quality

Per base quality graph

[OK] Per sequence quality scores

Per Sequence quality graph

[OK] Per base sequence content

Per base sequence content

[OK] Per base GC content

Per base GC content graph

[OK] Per sequence GC content

Per sequence GC content graph

[OK] Per base N content

N content graph

[OK] Sequence Length Distribution

Sequence length distribution

[OK] Sequence Duplication Levels

Duplication level graph

[WARN] Overrepresented sequences

Sequence Count Percentage Possible Source
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 88857 0.32317663901750987 No Hit
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA 61337 0.22308524378965078 Illumina Single End Adapter 2 (100% over 33bp)

[WARN] Kmer Content

Kmer graph

Sequence Count Obs/Exp Overall Obs/Exp Max Max Obs/Exp Position
TGTGT 3028770 3.7093418 4.64466 3
ACACA 3150520 3.6310139 3.859405 3
GTGTG 2808085 3.3810282 4.1900992 4
CACAC 2997630 3.374738 3.5919025 1
CTGCT 1965455 2.2919111 6.111965 27
GGAAG 1808455 2.1361198 13.788122 5
TTCTG 1722430 2.0759656 6.1629558 25
CTTCT 1692435 2.0074222 6.0121408 24
TCTGC 1678765 1.9576027 5.8145604 26
GAAGA 1566445 1.8640808 12.87405 6
TGCTT 1545170 1.8623227 5.878784 28
TCTTC 1503460 1.783276 5.708275 23
AAGAG 1476470 1.7570096 10.817974 7
AGAGC 1369815 1.5923108 7.23938 8
GAGCT 1282240 1.5048583 6.78797 9
AGCTC 1270655 1.4675807 5.764755 10
ATGCC 1264240 1.4601713 5.3668747 17
GTCTT 1138275 1.3719108 5.267899 22
GTATG 918645 1.1143407 5.1046276 15
CGGAA 700890 0.81473386 12.378599 4
GATCG 685695 0.8047431 12.5605 1
ATCGG 587225 0.68917704 12.428017 2
TCGGA 573765 0.6733801 12.330415 3